Erratum: Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17

Publikation: Bidrag til tidsskrift › Kommentar/debat › Forskning › fagfællebedømt

Standard

Erratum : Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17. / Martínez-Alvarez, Laura; Deng, Ling; Peng, Xu.

I: Journal of Virology, Bind 92, Nr. 7, e01991-17, 01.04.2018.

Publikation: Bidrag til tidsskrift › Kommentar/debat › Forskning › fagfællebedømt

Harvard

Martínez-Alvarez, L, Deng, L & Peng, X 2018, 'Erratum: Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17', Journal of Virology, bind 92, nr. 7, e01991-17. https://doi.org/10.1128/JVI.01991-17

APA

Martínez-Alvarez, L., Deng, L., & Peng, X. (2018). Erratum: Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17. Journal of Virology, 92(7), [e01991-17]. https://doi.org/10.1128/JVI.01991-17

Vancouver

Martínez-Alvarez L, Deng L, Peng X. Erratum: Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17. Journal of Virology. 2018 apr. 1;92(7). e01991-17. https://doi.org/10.1128/JVI.01991-17

Author

Martínez-Alvarez, Laura ; Deng, Ling ; Peng, Xu. / Erratum : Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17. I: Journal of Virology. 2018 ; Bind 92, Nr. 7.

Bibtex

@article{0084c158d801471599e5f58ddf83db44,
title = "Erratum: Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17",
abstract = "Volume 91, no. 13, e00486-17, 2017, https://doi.org/10.1128/JVI.00486-17. Page 10, Table 2, line 1: The sequence for oligonucleotide {"}Spacer dpo1 F{"} should read {"}AAAG TTGGGTACTTTACCTACTTTATCTGGTTCAAGATCTACTA{"}.",
author = "Laura Mart{\'i}nez-Alvarez and Ling Deng and Xu Peng",
note = "Publisher Copyright: {\textcopyright} 2018 American Society for Microbiology.",
year = "2018",
month = apr,
day = "1",
doi = "10.1128/JVI.01991-17",
language = "English",
volume = "92",
journal = "Journal of Virology",
issn = "0022-538X",
publisher = "American Society for Microbiology",
number = "7",

}

RIS

TY - JOUR

T1 - Erratum

T2 - Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17

AU - Martínez-Alvarez, Laura

AU - Deng, Ling

AU - Peng, Xu

N1 - Publisher Copyright: © 2018 American Society for Microbiology.

PY - 2018/4/1

Y1 - 2018/4/1

N2 - Volume 91, no. 13, e00486-17, 2017, https://doi.org/10.1128/JVI.00486-17. Page 10, Table 2, line 1: The sequence for oligonucleotide "Spacer dpo1 F" should read "AAAG TTGGGTACTTTACCTACTTTATCTGGTTCAAGATCTACTA".

AB - Volume 91, no. 13, e00486-17, 2017, https://doi.org/10.1128/JVI.00486-17. Page 10, Table 2, line 1: The sequence for oligonucleotide "Spacer dpo1 F" should read "AAAG TTGGGTACTTTACCTACTTTATCTGGTTCAAGATCTACTA".

UR - http://www.scopus.com/inward/record.url?scp=85043757422&partnerID=8YFLogxK

U2 - 10.1128/JVI.01991-17

DO - 10.1128/JVI.01991-17

M3 - Comment/debate

C2 - 29540560

AN - SCOPUS:85043757422

VL - 92

JO - Journal of Virology

JF - Journal of Virology

SN - 0022-538X

IS - 7

M1 - e01991-17

ER -

ID: 371193853