Erratum: Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17
Publikation: Bidrag til tidsskrift › Kommentar/debat › Forskning › fagfællebedømt
Volume 91, no. 13, e00486-17, 2017, https://doi.org/10.1128/JVI.00486-17. Page 10, Table 2, line 1: The sequence for oligonucleotide "Spacer dpo1 F" should read "AAAG TTGGGTACTTTACCTACTTTATCTGGTTCAAGATCTACTA".
Originalsprog | Engelsk |
---|---|
Artikelnummer | e01991-17 |
Tidsskrift | Journal of Virology |
Vol/bind | 92 |
Udgave nummer | 7 |
ISSN | 0022-538X |
DOI |
|
Status | Udgivet - 1 apr. 2018 |
Bibliografisk note
Publisher Copyright:
© 2018 American Society for Microbiology.
ID: 371193853